Completed Puzzles
Puzzle PZ1
Results
Description
knowing that the crystal structure shows a homodimer that contains two strands of the sequence. The strands hybridize with blunt ends (C-G closing base pairs).
RNA sequence (5' to 3')
CCGCCGCGCCAUGCCUGUGGCGG
Experimental structure(s)
References
S.M. Dibrov, J. McLean and T. Hermann (2011). Structure of an RNA dimer of a regulatory element from human thymidylate synthase mRNA, Acta Cryst. D, Biological Crystallography 67: 97-104.
PDB ID:
Opening date:
19 Oct 2020, 23:24
Closing date (Human category):
19 Oct 2020, 23:24
Hide or show column:
Metric | Webserver category | Human category | ||
---|---|---|---|---|
Median | Mean | Median | Mean | |
Clashscore | - | - | 13.170 | 24.796 |
DI | - | - | 5.909 | 5.948 |
INF all | - | - | 0.836 | 0.840 |
INF nwc | - | - | 0.000 | 0.000 |
INF stacking | - | - | 0.817 | 0.821 |
INF wc | - | - | 0.900 | 0.884 |
MCQ | - | - | 13.595 | 15.008 |
P-Value | - | - | 0.000 | 0.000 |
RMSD | - | - | 4.754 | 4.931 |
Result visualization for different evaluation measures