Completed Puzzles Puzzle PZ11 Results

Description
7SK
RNA sequence (5' to 3')
GGGAUCUGUCACCCCAUUGAUCGCCUUCGGGCUGAUCUGGCUGG CUAGGCGGGUCCC
Experimental structure(s)
References

D. Martinez-Zapien, P. Legrand, A. G. McEwen, F. Proux, T. Cragnolini, S. Pasquali and A. C. Dock-Bregeon (2017) The crystal structure of the 5΄ functional domain of the transcription riboregulator 7SK. Nucleic Acids Res. 45(6): 3568-3579.
S. Bourbigot, A. C. Dock-Bregeon, P. Eberling, J. Coutant, B. Kieffer and I. Lebars (2016) Solution structure of the 5-terminal hairpin of the 7SK small nuclear RNA. RNA. 2016 22(12): 1844-1858.

PDB ID:
Opening date:
19 Oct 2020, 23:24
Closing date (Human category):
19 Oct 2020, 23:24

Hide or show column:

Metric Webserver category Human category
Median Mean Median Mean
Clashscore - - 8.780 7.362
DI - - 11.071 11.401
INF all - - 0.740 0.731
INF nwc - - 0.000 0.011
INF stacking - - 0.734 0.733
INF wc - - 0.879 0.873
MCQ - - 24.910 24.453
P-Value - - 0.048 0.141
RMSD - - 7.969 8.254

Result visualization for different evaluation measures

Violin plot for Clashscore