Completed Puzzles Puzzle PZ14Free Results
Description
L-glutamine riboswitch. Predict Free forms.
RNA sequence (5' to 3')
CGUUGGCCCAGGAAACUGGGUGGAAGUAAGGCCCAUUGCACUCCGGGCCUGAAG CAACGCU
Experimental structure(s)
08KQQIPoYh7OQVTnzcPgXsEQgYmdFAtE-solutionPZ14Free.pdb iCD34k0ZB9EXnZwnOYwqiQeCdKfjYtzO-solutionPZ14Free_1.pdb
References

A. Ren, Y. Xue, A. Peselis, A. Serganov, H. M. Al-Hashimi and D. J. Patel (2015) Structural and Dynamic Basis for Low-Affinity, High- Selectivity Binding of L-Glutamine by the Glutamine Riboswitch. Cell Rep. 13(9): 1800-1813

PDB ID:
5ddo
Opening date:
01 Aug 2015, 23:24
Closing date (Human category):
31 Aug 2015, 23:24

Hide or show column:

# Group (User) Model(s) Category Clashscore
DI
INF all
INF nwc
INF stacking
INF wc
MCQ
P-Value
RMSD
Details
1 Das Group (DasPostExp ) 2 Human 10.660 8.276 0.787 0.354 0.805 0.884 24.630 0.000 6.513
2 Das Group (DasPostExp ) 6 Human 16.240 7.838 0.880 0.913 0.865 0.913 22.960 0.000 6.895
3 Das Group (DasPreExp ) 1 Human 16.240 7.838 0.880 0.913 0.865 0.913 22.960 0.000 6.895
4 Ding Group (DingPostExp ) 8 Human 14.210 10.006 0.706 0.000 0.671 0.968 29.360 0.000 7.063
5 Das Group (DasPostExp ) 3 Human 5.580 8.135 0.868 0.913 0.857 0.889 22.960 0.000 7.065
6 Ding Group (DingPostExp ) 9 Human 11.170 10.675 0.674 0.000 0.559 1.000 27.560 0.000 7.199
7 Ding Group (DingPostExp ) 6 Human 13.200 10.612 0.711 0.000 0.627 0.938 26.060 0.000 7.543
8 Das Group (DasPreExp ) 9 Human 4.570 10.120 0.828 0.913 0.795 0.889 21.780 0.000 8.382
9 Das Group (DasPostExp ) 5 Human 5.580 10.613 0.816 0.772 0.795 0.889 24.150 0.000 8.658
10 Ding Group (DingPostExp ) 4 Human 13.710 13.699 0.636 0.000 0.573 0.913 28.080 0.000 8.719
11 Ding Group (DingPreExp ) 4 Human 16.750 12.531 0.713 0.000 0.682 0.968 26.760 0.000 8.931
12 Chen Group (ChenPostExp ) 2 Human 7.090 11.824 0.791 0.289 0.801 0.904 25.950 0.000 9.356
13 Ding Group (DingPreExp ) 1 Human 11.680 13.681 0.695 0.000 0.662 0.933 26.650 0.000 9.507
14 Das Group (DasPostExp ) 10 Human 6.090 11.848 0.825 0.913 0.791 0.889 25.850 0.000 9.775
15 Das Group (DasPreExp ) 5 Human 6.090 11.848 0.825 0.913 0.791 0.889 25.850 0.000 9.775
16 Ding Group (DingPostExp ) 10 Human 11.680 12.930 0.779 - 0.687 1.000 28.960 0.000 10.069
17 Das Group (DasPreExp ) 3 Human 8.630 13.163 0.766 0.408 0.741 0.918 26.200 0.000 10.086
18 Chen Group (ChenPostExp ) 5 Human 1.520 13.302 0.794 0.408 0.786 0.933 26.370 0.000 10.563
19 Chen Group (ChenPostExp ) 6 Human 6.070 14.695 0.772 0.408 0.751 0.933 26.210 0.000 11.337
20 Das Group (DasPostExp ) 7 Human 5.580 13.928 0.819 0.816 0.795 0.889 21.170 0.000 11.406
21 Bujnicki Group (BujnickiPreExp ) 3 Human 8.630 14.694 0.789 0.408 0.764 0.968 25.810 0.000 11.601
22 Ding Group (DingPostExp ) 3 Human 15.230 17.336 0.727 0.000 0.714 0.913 26.770 0.000 12.600
23 Bujnicki Group (BujnickiPreExp ) 1 Human 3.550 13.974 0.912 0.913 0.892 0.968 24.620 0.000 12.745
24 Chen Group (ChenPostExp ) 7 Human 5.060 17.322 0.757 0.000 0.693 0.968 25.660 0.000 13.114
25 Bujnicki Group (BujnickiPostExp ) 1 Human 14.740 16.751 0.790 0.816 0.751 0.889 25.680 0.000 13.240
26 Bujnicki Group (BujnickiPreExp ) 4 Human 7.610 21.354 0.651 - 0.617 0.845 25.970 0.000 13.897
27 Chen Group (ChenPostExp ) 10 Human 5.560 18.865 0.784 0.000 0.723 1.000 23.560 0.000 14.796
28 Bujnicki Group (BujnickiPostExp ) 2 Human 22.850 19.372 0.779 0.730 0.751 0.877 23.040 0.001 15.094
29 Bujnicki Group (BujnickiPostExp ) 3 Human 12.700 25.204 0.634 0.000 0.600 0.845 25.300 0.003 15.983
30 Ding Group (DingPostExp ) 1 Human 14.210 23.535 0.699 0.000 0.683 0.889 24.340 0.007 16.461
31 Chen Group (ChenPostExp ) 1 Human 6.070 24.412 0.690 0.000 0.608 0.968 25.090 0.013 16.851
32 Ding Group (DingPostExp ) 7 Human 9.640 25.387 0.673 - 0.610 0.939 27.130 0.017 17.081
33 Bujnicki Group (BujnickiPreExp ) 2 Human 9.140 20.406 0.844 0.707 0.815 0.968 27.640 0.021 17.217
34 Bujnicki Group (BujnickiPostExp ) 4 Human 23.860 23.218 0.774 0.707 0.732 0.913 30.570 0.053 17.978
35 Chen Group (ChenPostExp ) 8 Human 4.550 23.596 0.787 0.500 0.741 0.968 24.730 0.099 18.560
36 Chen Group (ChenPostExp ) 9 Human 5.060 23.926 0.787 0.408 0.777 0.933 25.090 0.128 18.837
37 Chen Group (ChenPostExp ) 4 Human 2.020 22.585 0.839 0.913 0.795 0.933 25.800 0.141 18.944
38 Chen Group (ChenPostExp ) 3 Human 8.600 28.966 0.752 0.447 0.700 0.968 20.260 0.694 21.793
Metric Webserver category Human category
Median Mean Median Mean
Clashscore - - 8.630 9.774
DI - - 13.951 16.012
INF all - - 0.782 0.769
INF nwc - - 0.408 0.407
INF stacking - - 0.746 0.733
INF wc - - 0.926 0.926
MCQ - - 25.805 25.461
P-Value - - 0.000 0.031
RMSD - - 11.372 12.172

Result visualization for different evaluation measures

Violin plot for Clashscore
Violin plot for DI
Violin plot for INF all
Violin plot for INF nwc
Violin plot for INF stacking
Violin plot for INF wc
Violin plot for MCQ
Violin plot for P-Value
Violin plot for RMSD