Completed Puzzles Puzzle PZ14Bound Results

Description
L-glutamine riboswitch. Predict Bound forms.
RNA sequence (5' to 3')
CGUUGACCCAGGAAACUGGGCGGAAGUAAGGCCCAUUGCACUCCGGGCCUGAAG CAACGCG
Experimental structure(s)
References

A. Ren, Y. Xue, A. Peselis, A. Serganov, H. M. Al-Hashimi and D. J. Patel (2015) Structural and Dynamic Basis for Low-Affinity, High- Selectivity Binding of L-Glutamine by the Glutamine Riboswitch. Cell Rep. 13(9): 1800-1813

PDB ID:
Opening date:
01 Aug 2015, 23:24
Closing date (Human category):
31 Aug 2015, 23:24

Hide or show column:

Metric Webserver category Human category
Median Mean Median Mean
Clashscore - - 8.110 9.098
DI - - 16.606 15.849
INF all - - 0.757 0.738
INF nwc - - 0.577 0.437
INF stacking - - 0.722 0.707
INF wc - - 0.938 0.934
MCQ - - 21.885 21.860
P-Value - - 0.000 0.000
RMSD - - 11.636 11.542

Result visualization for different evaluation measures

Violin plot for Clashscore