Completed Puzzles Puzzle PZ14Bound Results

Description
L-glutamine riboswitch. Predict Bound forms.
RNA sequence (5' to 3')
CGUUGACCCAGGAAACUGGGCGGAAGUAAGGCCCAUUGCACUCCGGGCCUGAAG CAACGCG
Experimental structure(s)
References

A. Ren, Y. Xue, A. Peselis, A. Serganov, H. M. Al-Hashimi and D. J. Patel (2015) Structural and Dynamic Basis for Low-Affinity, High- Selectivity Binding of L-Glutamine by the Glutamine Riboswitch. Cell Rep. 13(9): 1800-1813

PDB ID:
Opening date:
01 Aug 2015, 23:24
Closing date (Human category):
31 Aug 2015, 23:24

Hide or show column:

# Group (User) Model(s) Category Clashscore
DI
INF all
INF nwc
INF stacking
INF wc
MCQ
P-Value
RMSD
Details
1 Bujnicki Group (BujnickiPreExp ) 2 Human 9.120 6.226 0.802 0.667 0.767 0.968 22.710 0.000 4.994
2 Bujnicki Group (BujnickiPreExp ) 1 Human 8.110 7.190 0.788 0.596 0.741 1.000 20.890 0.000 5.665
3 Bujnicki Group (BujnickiPreExp ) 4 Human 11.180 7.926 0.742 0.577 0.701 0.918 19.530 0.000 5.879
4 Bujnicki Group (BujnickiPreExp ) 3 Human 8.610 8.448 0.797 0.596 0.756 1.000 21.950 0.000 6.731
5 Das Group (DasPreExp ) 6 Human 11.650 8.902 0.814 0.722 0.801 0.894 22.660 0.000 7.249
6 Bujnicki Group (BujnickiPreExp ) 5 Human 0.000 9.779 0.766 0.632 0.739 0.894 20.970 0.000 7.491
7 Chen Group (ChenPostExp ) 6 Human 0.000 10.945 0.692 0.333 0.645 0.968 22.520 0.000 7.570
8 Chen Group (ChenPostExp ) 2 Human 0.000 10.567 0.723 0.250 0.701 0.938 23.800 0.000 7.641
9 Das Group (DasPreExp ) 9 Human 6.080 9.516 0.809 0.722 0.792 0.894 19.580 0.000 7.694
10 Chen Group (ChenPostExp ) 5 Human 0.510 11.492 0.701 0.333 0.660 0.968 22.950 0.000 8.059
11 Das Group (DasPreExp ) 8 Human 6.590 10.151 0.794 0.577 0.783 0.918 19.420 0.000 8.064
12 Das Group (DasPostExp ) 10 Human 5.570 12.112 0.794 0.791 0.753 0.918 22.320 0.000 9.621
13 Das Group (DasPreExp ) 5 Human 5.570 12.112 0.794 0.791 0.753 0.918 22.320 0.000 9.621
14 Chen Group (ChenPostExp ) 7 Human 0.510 15.874 0.682 0.333 0.629 0.968 23.610 0.000 10.825
15 Bujnicki Group (BujnickiPreExp ) 6 Human 8.110 13.392 0.818 0.745 0.810 0.884 21.420 0.000 10.957
16 Chen Group (ChenPostExp ) 9 Human 0.510 14.837 0.739 0.204 0.726 0.968 20.180 0.000 10.958
17 Ding Group (DingPostExp ) 1 Human 11.140 17.344 0.642 0.000 0.616 0.968 24.000 0.000 11.126
18 Das Group (DasPostExp ) 7 Human 2.530 14.997 0.765 0.596 0.745 0.894 19.330 0.000 11.473
19 Das Group (DasPreExp ) 2 Human 2.530 14.997 0.765 0.596 0.745 0.894 19.330 0.000 11.473
20 Bujnicki Group (BujnickiPostExp ) 5 Human 23.300 16.389 0.703 0.667 0.645 0.884 26.180 0.000 11.517
21 Das Group (DasPostExp ) 2 Human 8.610 14.991 0.774 0.745 0.737 0.894 21.580 0.000 11.607
22 Das Group (DasPreExp ) 7 Human 12.160 14.584 0.797 0.722 0.765 0.918 21.040 0.000 11.630
23 Das Group (DasPostExp ) 5 Human 6.080 15.440 0.754 0.722 0.712 0.884 20.000 0.000 11.641
24 Ding Group (DingPostExp ) 8 Human 16.200 16.823 0.701 0.000 0.690 0.968 21.520 0.000 11.793
25 Ding Group (DingPostExp ) 2 Human 13.680 17.636 0.675 0.000 0.641 0.968 23.140 0.000 11.900
26 Ding Group (DingPostExp ) 9 Human 11.140 18.028 0.694 0.000 0.690 0.968 25.990 0.000 12.520
27 Bujnicki Group (BujnickiPostExp ) 4 Human 28.400 20.874 0.608 0.333 0.553 0.860 25.040 0.000 12.688
28 Ding Group (DingPreExp ) 2 Human 16.210 18.905 0.675 0.000 0.650 0.968 23.160 0.000 12.756
29 Ding Group (DingPostExp ) 5 Human 21.280 18.469 0.694 0.000 0.690 0.938 22.520 0.000 12.826
30 Ding Group (DingPreExp ) 3 Human 16.210 18.144 0.715 0.000 0.686 1.000 22.610 0.000 12.965
31 Ding Group (DingPreExp ) 1 Human 13.680 20.072 0.685 0.000 0.686 0.968 25.660 0.000 13.742
32 Bujnicki Group (BujnickiPostExp ) 2 Human 29.380 22.016 0.633 0.204 0.601 0.860 24.700 0.000 13.936
33 Bujnicki Group (BujnickiPostExp ) 1 Human 18.740 18.146 0.773 0.612 0.729 0.968 21.690 0.000 14.018
34 Ding Group (DingPreExp ) 7 Human 16.210 21.634 0.655 0.000 0.636 0.938 24.350 0.000 14.161
35 Ding Group (DingPostExp ) 3 Human 10.640 19.191 0.739 0.000 0.765 0.884 24.010 0.000 14.178
36 Szachniuk Group (formerly: Adamiak Group) (AdamiakPostExp ) 2 Human 14.710 18.663 0.780 0.471 0.754 0.968 20.150 0.000 14.564
37 Chen Group (ChenPostExp ) 8 Human 2.530 19.336 0.760 0.500 0.728 0.968 21.110 0.000 14.690
38 Szachniuk Group (formerly: Adamiak Group) (AdamiakPostExp ) 1 Human 5.580 19.460 0.776 0.745 0.735 0.904 16.270 0.000 15.097
39 Chen Group (ChenPostExp ) 4 Human 0.000 19.115 0.798 0.722 0.751 0.968 22.640 0.000 15.256
40 Chen Group (ChenPostExp ) 3 Human 3.550 20.613 0.763 0.745 0.697 0.968 19.930 0.001 15.719
41 Szachniuk Group (formerly: Adamiak Group) (AdamiakPreExp ) 1 Human 5.070 20.410 0.776 0.745 0.735 0.904 17.620 0.001 15.834
42 Szachniuk Group (formerly: Adamiak Group) (AdamiakPreExp ) 2 Human 8.110 21.146 0.760 0.680 0.719 0.904 19.290 0.001 16.064
43 Chen Group (ChenPostExp ) 10 Human 0.000 23.078 0.710 0.333 0.688 0.938 20.320 0.002 16.396
44 Chen Group (ChenPostExp ) 1 Human 0.510 27.366 0.630 0.236 0.568 0.938 21.820 0.008 17.250
Metric Webserver category Human category
Median Mean Median Mean
Clashscore - - 8.110 9.098
DI - - 16.606 15.849
INF all - - 0.757 0.738
INF nwc - - 0.577 0.437
INF stacking - - 0.722 0.707
INF wc - - 0.938 0.934
MCQ - - 21.885 21.860
P-Value - - 0.000 0.000
RMSD - - 11.636 11.542

Result visualization for different evaluation measures

Violin plot for Clashscore
Violin plot for DI
Violin plot for INF all
Violin plot for INF nwc
Violin plot for INF stacking
Violin plot for INF wc
Violin plot for MCQ
Violin plot for P-Value
Violin plot for RMSD