Completed Puzzles Puzzle PZ18 Results
Description
Zika virus.
RNA sequence (5' to 3')
GGGUCAGGCCGGCGAAAGUCGCCACAGUUUGGGGAAAGCUGUGCAGCCUG UAACCCCCCCACGAAAGUGGG
Experimental structure(s)
ZOnMiQujJsXhmW8BiPTjAod6ISCGlrIv-solutionPZ18.pdb
References

B. M. Akiyama, H. M. Laurence, A. R. Massey, D. A. Costantino, X. Xie, Y. Yang, P. Y. Shi, J. C. Nix, J. D. Beckham and J. S. Kieft (2016) Zika virus produces noncoding RNAs using a multi-pseudoknot structure that confounds a cellular exonuclease. Science 354: 1148-1152

PDB ID:
5tpy
Opening date:
24 Oct 2016, 22:24
Closing date (Human category):
10 Nov 2016, 23:24
Closing date (Webserver category):
26 Oct 2016, 23:24

Display:
Hide or show column:

# Group (User) Model(s) Category Clashscore
DI
INF all
INF nwc
INF stacking
INF wc
MCQ
P-Value
RMSD
Details
1 Das Group (DasORIGINAL ) 3 Human 8.700 3.696 0.868 0.667 0.840 0.981 16.110 0.000 3.208
2 Chen Group (Chen ) 1 Human 0.430 4.710 0.794 0.577 0.738 0.962 24.850 0.000 3.740
3 Das Group (Das ) 2 Human 16.090 4.442 0.873 0.548 0.857 0.981 16.150 0.000 3.877
4 Das Group (DasORIGINAL ) 2 Human 9.130 4.613 0.874 0.667 0.850 0.981 16.030 0.000 4.034
5 Das Group (Das ) 1 Human 13.050 6.447 0.852 0.617 0.824 0.981 16.590 0.000 5.496
6 Das Group (DasORIGINAL ) 1 Human 9.570 6.512 0.865 0.577 0.850 0.981 16.280 0.000 5.633
7 Das Group (Das ) 3 Human 9.570 6.512 0.865 0.577 0.850 0.981 16.280 0.000 5.633
8 Das Group (DasORIGINAL ) 4 Human 13.050 6.682 0.853 0.365 0.851 0.962 16.680 0.000 5.698
9 Das Group (Das ) 4 Human 13.050 6.682 0.853 0.365 0.851 0.962 16.680 0.000 5.698
10 Chen Group (Chen ) 2 Human 2.170 8.010 0.828 0.577 0.794 0.960 26.760 0.000 6.636
11 Dokholyan Group (Dokholyan ) 3 Human 13.480 12.166 0.650 0.000 0.607 0.840 24.910 0.000 7.903
12 Dokholyan Group (Dokholyan ) 1 Human 9.570 11.983 0.704 0.000 0.694 0.824 23.070 0.000 8.440
13 Chen Group (Chen ) 3 Human 4.780 13.034 0.703 0.000 0.720 0.760 24.660 0.000 9.165
14 Chen Group (Chen ) 4 Human 4.780 13.618 0.681 0.000 0.680 0.776 24.020 0.000 9.273
15 Das Group (Das ) 2 Server 5.220 15.023 0.654 0.365 0.623 0.784 15.780 0.000 9.820
16 Bujnicki Group (Bujnicki ) 2 Server 87.750 16.650 0.617 0.236 0.609 0.706 20.890 0.000 10.277
17 Das Group (Das ) 6 Server 3.910 15.535 0.666 0.289 0.640 0.784 17.850 0.000 10.342
18 Das Group (DasORIGINAL ) 5 Human 19.570 13.596 0.802 0.365 0.798 0.917 19.660 0.000 10.904
19 Das Group (Das ) 5 Human 19.570 13.596 0.802 0.365 0.798 0.917 19.660 0.000 10.904
20 Das Group (Das ) 4 Server 3.480 16.644 0.691 0.471 0.676 0.770 16.270 0.000 11.509
21 Dokholyan Group (Dokholyan ) 2 Human 14.790 16.566 0.722 - 0.720 0.808 22.640 0.000 11.954
22 Xiao Group (Xiao ) 4 Server 0.870 18.355 0.678 0.000 0.678 0.784 27.640 0.000 12.449
23 Das Group (Das ) 3 Server 10.440 18.461 0.677 0.408 0.659 0.770 16.960 0.000 12.490
24 Das Group (Das ) 5 Server 8.260 19.974 0.669 0.408 0.647 0.770 19.130 0.000 13.362
25 Das Group (Das ) 10 Server 6.520 19.874 0.673 0.408 0.654 0.770 18.210 0.000 13.383
26 Das Group (Das ) 7 Server 7.390 21.865 0.684 0.408 0.671 0.770 15.950 0.000 14.957
27 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 5 Server 13.920 23.841 0.638 0.408 0.603 0.760 20.460 0.000 15.211
28 Das Group (Das ) 8 Server 3.480 23.750 0.661 0.471 0.628 0.770 19.070 0.000 15.707
29 Chen Group (Chen ) 5 Human 1.310 22.613 0.701 0.000 0.723 0.760 21.940 0.000 15.848
30 Feng Group (Feng ) 5 Human 9.130 24.417 0.661 0.000 0.652 0.784 20.700 0.000 16.148
31 Das Group (Das ) 1 Server 6.520 24.592 0.665 0.365 0.640 0.784 17.820 0.000 16.346
32 Feng Group (Feng ) 3 Human 7.830 25.064 0.656 0.000 0.692 0.680 21.900 0.000 16.450
33 Das Group (Das ) 9 Server 1.740 25.385 0.678 0.471 0.647 0.784 17.060 0.000 17.208
34 Lee Group (LeeASmodel ) 5 Human 2.170 30.696 0.601 - 0.615 0.640 19.170 0.001 18.454
35 Yagoubali Group (YagoubAli ) 1 Human 8.290 29.242 0.637 0.408 0.590 0.784 24.920 0.001 18.636
36 Xiao Group (Xiao ) 1 Server 11.740 26.653 0.706 0.408 0.696 0.784 27.280 0.002 18.821
37 Lee Group (LeeASmodel ) 4 Human 4.780 31.896 0.593 - 0.602 0.640 20.360 0.002 18.918
38 Xiao Group (Xiao ) 2 Server 0.430 26.593 0.722 0.471 0.727 0.760 23.010 0.004 19.207
39 Feng Group (Feng ) 1 Human 10.440 32.433 0.625 0.289 0.634 0.667 19.420 0.018 20.280
40 Xiao Group (Xiao ) 3 Server 12.610 28.092 0.722 0.408 0.707 0.816 24.450 0.018 20.287
41 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 3 Server 10.870 30.820 0.669 0.408 0.697 0.667 22.810 0.029 20.619
42 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 1 Server 12.610 30.055 0.690 0.471 0.666 0.784 23.480 0.033 20.737
43 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 4 Server 10.870 29.664 0.700 0.408 0.689 0.784 22.010 0.035 20.774
44 Feng Group (Feng ) 2 Human 10.870 30.104 0.702 0.000 0.707 0.784 19.690 0.053 21.130
45 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 2 Server 10.870 30.191 0.700 0.471 0.669 0.816 23.950 0.054 21.143
46 Lee Group (Lee ) 2 Human 3.910 34.275 0.617 - 0.638 0.640 18.730 0.054 21.159
47 Lee Group (Lee ) 3 Human 1.740 49.883 0.429 0.000 0.516 0.292 21.570 0.073 21.421
48 Lee Group (LeeASmodel ) 3 Human 3.480 49.204 0.435 0.000 0.525 0.298 23.040 0.073 21.425
49 Lee Group (Lee ) 4 Human 3.910 38.097 0.582 - 0.591 0.628 18.450 0.147 22.158
50 Lee Group (Lee ) 1 Human 1.740 40.661 0.561 0.289 0.558 0.616 18.410 0.243 22.793
51 Bujnicki Group (Bujnicki ) 1 Server 100.480 45.528 0.508 0.408 0.622 0.292 21.050 0.308 23.141
52 Lee Group (LeeASmodel ) 1 Human 0.870 42.331 0.547 0.000 0.558 0.628 20.370 0.314 23.172
53 Lee Group (LeeASmodel ) 2 Human 4.350 38.064 0.617 - 0.639 0.640 20.550 0.381 23.498
54 Xiao Group (Xiao ) 5 Server 0.430 36.510 0.660 0.236 0.650 0.760 28.850 0.510 24.091
55 Lee Group (Lee ) 5 Human 2.170 42.252 0.581 - 0.584 0.640 19.000 0.610 24.549
56 Bujnicki Group (Bujnicki ) 3 Server 100.780 41.976 0.587 0.289 0.615 0.577 20.650 0.628 24.633
57 Feng Group (Feng ) 4 Human 8.260 52.159 0.478 - 0.591 0.280 19.720 0.688 24.924
Metric Webserver category Human category
Median Mean Median Mean
Clashscore 8.260 18.747 8.275 7.841
DI 24.592 25.480 19.590 22.537
INF all 0.673 0.666 0.691 0.694
INF nwc 0.408 0.378 0.000 0.213
INF stacking 0.654 0.657 0.693 0.698
INF wc 0.770 0.741 0.784 0.764
MCQ 20.650 20.897 19.705 20.264
P-Value 0.000 0.070 0.000 0.078
RMSD 16.346 16.805 13.901 13.799

Result visualization for different evaluation measures

Violin plot for Clashscore
Violin plot for DI
Violin plot for INF all
Violin plot for INF nwc
Violin plot for INF stacking
Violin plot for INF wc
Violin plot for MCQ
Violin plot for P-Value
Violin plot for RMSD