Completed Puzzles Puzzle PZ19 Results
Description
One Twister Sister robozyme
RNA sequence (5' to 3')
GCAGGGCAAGGCCCAGUCCCGUGCAAGCCGGGACCGCCCC- GGGGCGCGGCGCUCAUUCCUGC
Experimental structure(s)
fXE0CsYjxtyxNWWWkrNcoX93qesgUsbR-solutionPZ19.pdb
References

Y. Liu, T. J. Wilson and D. M. J. Lilley (2017) The structure of a nucleolytic ribozyme that employs a catalytic metal ion. Nature Chemical Biology, 13: 508–513

PDB ID:
5t5a
Opening date:
24 Oct 2016, 23:24
Closing date (Human category):
10 Nov 2016, 23:24
Closing date (Webserver category):
26 Oct 2016, 23:24

Display:
Hide or show column:

# Group (User) Model(s) Category Clashscore
DI
INF all
INF nwc
INF stacking
INF wc
MCQ
P-Value
RMSD
Details
1 Chen Group (Chen ) 1 Human 18.970 7.480 0.738 0.000 0.703 0.909 23.500 0.000 5.517
2 Chen Group (Chen ) 2 Human 0.500 10.990 0.671 0.577 0.659 0.711 27.490 0.000 7.380
3 Das Group (Das ) 2 Human 9.490 12.416 0.722 0.192 0.728 0.864 18.800 0.000 8.968
4 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 3 Server 11.480 15.485 0.620 0.000 0.615 0.682 21.820 0.000 9.596
5 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 5 Human 5.490 14.617 0.672 0.333 0.689 0.685 20.360 0.000 9.822
6 Chen Group (Chen ) 4 Human 0.000 13.025 0.761 0.408 0.696 0.934 24.170 0.000 9.906
7 Bujnicki Group (Bujnicki ) 2 Human 4.490 15.156 0.672 0.000 0.695 0.682 18.560 0.000 10.183
8 Das Group (Das ) 5 Human 8.990 15.741 0.657 0.000 0.645 0.753 18.250 0.000 10.345
9 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 2 Server 9.990 16.277 0.662 0.333 0.659 0.711 20.960 0.000 10.775
10 Das Group (Das ) 4 Human 12.980 14.645 0.736 0.408 0.715 0.818 21.500 0.000 10.781
11 Lee Group (Lee ) 2 Server 1.000 18.660 0.587 0.000 0.590 0.636 22.180 0.000 10.951
12 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 1 Human 7.990 17.820 0.629 0.000 0.622 0.696 18.420 0.000 11.203
13 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 5 Server 11.480 17.285 0.662 0.577 0.645 0.711 22.380 0.000 11.443
14 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 4 Human 6.990 19.761 0.621 0.000 0.599 0.744 17.680 0.000 12.268
15 Das Group (Das ) 3 Human 5.490 17.610 0.708 0.258 0.698 0.818 19.640 0.000 12.475
16 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 4 Server 12.980 21.810 0.577 0.000 0.543 0.696 25.090 0.000 12.595
17 Lee Group (Lee ) 4 Server 6.490 19.574 0.644 - 0.653 0.672 21.930 0.000 12.615
18 Xiao Group (Xiao ) 4 Server 4.000 20.584 0.638 0.000 0.667 0.667 33.250 0.000 13.139
19 Xiao Group (Xiao ) 2 Server 4.000 19.451 0.681 0.000 0.731 0.653 31.620 0.000 13.239
20 Bujnicki Group (Bujnicki ) 1 Human 1.500 19.911 0.690 0.000 0.730 0.669 19.100 0.000 13.734
21 Bujnicki Group (Bujnicki ) 3 Server 105.680 27.283 0.506 - 0.623 0.341 20.960 0.000 13.794
22 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 3 Human 7.490 24.227 0.577 0.000 0.569 0.685 17.650 0.000 13.990
23 Bujnicki Group (Bujnicki ) 2 Server 134.400 19.677 0.718 - 0.674 0.853 19.450 0.000 14.134
24 Bujnicki Group (Bujnicki ) 1 Server 108.390 22.220 0.648 - 0.659 0.669 19.810 0.000 14.396
25 Bujnicki Group (Bujnicki ) 4 Human 4.990 24.330 0.607 0.000 0.640 0.615 24.020 0.000 14.758
26 Ding Group (Ding ) 1 Human 8.490 21.586 0.692 - 0.705 0.711 17.700 0.000 14.934
27 Xiao Group (Xiao ) 5 Server 5.500 22.837 0.657 0.408 0.652 0.698 29.640 0.000 15.012
28 Xiao Group (Xiao ) 1 Server 4.500 21.457 0.700 0.408 0.725 0.682 28.340 0.000 15.021
29 Lee Group (Lee ) 1 Server 1.500 24.642 0.613 0.000 0.616 0.682 21.110 0.000 15.107
30 Das Group (Das ) 1 Human 14.480 22.376 0.682 0.333 0.646 0.800 22.340 0.000 15.259
31 Chen Group (Chen ) 3 Human 0.000 24.228 0.633 0.333 0.622 0.698 23.810 0.000 15.342
32 Xiao Group (Xiao ) 3 Server 6.000 22.796 0.676 0.577 0.696 0.656 31.570 0.000 15.410
33 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 1 Server 6.490 23.936 0.653 0.408 0.622 0.744 21.160 0.000 15.624
34 Das Group (Das ) 5 Server 7.990 32.007 0.489 0.000 0.653 0.256 17.100 0.000 15.662
35 Bujnicki Group (Bujnicki ) 3 Human 3.990 21.832 0.721 - 0.696 0.821 18.110 0.000 15.737
36 Das Group (Das ) 4 Server 10.990 36.461 0.432 0.000 0.553 0.261 18.010 0.000 15.742
37 Ding Group (Ding ) 2 Human 10.980 24.625 0.648 - 0.660 0.667 17.890 0.000 15.954
38 Lee Group (Lee ) 5 Server 4.490 24.036 0.674 - 0.675 0.724 19.290 0.001 16.204
39 Das Group (Das ) 2 Server 7.490 36.641 0.446 0.000 0.583 0.261 17.550 0.001 16.347
40 Bujnicki Group (Bujnicki ) 5 Human 1.000 23.841 0.690 0.000 0.729 0.669 21.690 0.001 16.460
41 Das Group (Das ) 6 Server 5.000 36.088 0.461 0.000 0.599 0.267 15.560 0.001 16.620
42 Dokholyan Group (Dokh ) 1 Human 6.490 25.680 0.648 - 0.645 0.698 21.490 0.001 16.643
43 Dokholyan Group (Dokholyan ) 1 Human 6.490 25.680 0.648 - 0.645 0.698 21.490 0.001 16.643
44 Das Group (Das ) 1 Server 4.000 36.422 0.461 0.000 0.599 0.251 16.110 0.002 16.774
45 Das Group (Das ) 8 Server 5.000 38.241 0.443 0.000 0.556 0.279 15.600 0.002 16.937
46 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 2 Human 6.990 28.243 0.601 0.000 0.581 0.744 18.320 0.002 16.986
47 Das Group (Das ) 3 Server 4.500 38.283 0.446 0.000 0.590 0.256 16.800 0.003 17.080
48 Ding Group (Ding ) 3 Human 7.990 25.582 0.673 - 0.685 0.696 20.180 0.004 17.213
49 Das Group (Das ) 7 Server 6.990 37.466 0.461 0.000 0.592 0.261 14.680 0.004 17.255
50 Ding Group (Ding ) 4 Human 12.980 29.944 0.577 - 0.615 0.532 20.400 0.004 17.265
51 Das Group (Das ) 10 Server 7.490 37.582 0.464 0.000 0.599 0.267 16.320 0.005 17.437
52 Das Group (Das ) 9 Server 5.990 37.868 0.464 0.000 0.599 0.261 14.210 0.006 17.569
53 Lee Group (Lee ) 3 Server 1.500 31.429 0.623 0.000 0.646 0.653 20.990 0.084 19.582
54 Ding Group (Ding ) 5 Human 8.490 30.988 0.648 - 0.714 0.539 19.280 0.136 20.084
55 Chen Group (Chen ) 5 Human 19.970 53.180 0.422 - 0.501 0.286 34.380 0.585 22.443
Metric Webserver category Human category
Median Mean Median Mean
Clashscore 6.245 18.047 6.990 7.544
DI 23.986 27.018 21.832 21.686
INF all 0.617 0.575 0.671 0.657
INF nwc 0.000 0.097 0.000 0.105
INF stacking 0.623 0.629 0.660 0.660
INF wc 0.655 0.527 0.698 0.709
MCQ 20.960 21.196 20.180 20.971
P-Value 0.000 0.004 0.000 0.027
RMSD 15.259 14.859 14.758 13.789

Result visualization for different evaluation measures

Violin plot for Clashscore
Violin plot for DI
Violin plot for INF all
Violin plot for INF nwc
Violin plot for INF stacking
Violin plot for INF wc
Violin plot for MCQ
Violin plot for P-Value
Violin plot for RMSD