Completed Puzzles Puzzle PZ20 Results
Description
Another Twister Sister ribozyme
RNA sequence (5' to 3')
ACCCGCAAGGCCGACGGC-GCCGCCGCUGGUGCAAGUCCAGCCACGCUUC GGCGUGGGCGCUCAUGGGU
Experimental structure(s)
sxYDagwoXVMt8kKnfiaOUjLMxhUQG7fh-solutionPZ20.pdb 9BAuGd8owPDrr2FElgf51qjyO76Aw5Rm-solutionPZ20_1.pdb 9pjZh5fIDUa0auaQ5ph4PYmHKUvAwmfx-solutionPZ20_2.pdb C4arBfzHXS29d7ZvFJZDctIBs8IfLVL6-solutionPZ20_3.pdb
References

L. Zheng, E. Mairhofer, M. Teplova, Y. Zhang, J. Ma, D. J. Patel, R. Micura and A. Ren (2017) Structure-based insights into self-cleavage by a four-way junctional twister-sister ribozyme. Nature Communications, 8: 1180

PDB ID:
5y85
Opening date:
17 May 2017, 23:24
Closing date (Human category):
14 Jun 2017, 23:24
Closing date (Webserver category):
19 May 2017, 23:24

Display:
Hide or show column:

# Group (User) Model(s) Category Clashscore
DI
INF all
INF nwc
INF stacking
INF wc
MCQ
P-Value
RMSD
Details
1 Bujnicki Group (Bujnicki ) 4 Human 35.550 5.695 0.826 0.577 0.810 0.898 17.880 0.000 4.705
2 Bujnicki Group (Bujnicki ) 1 Human 20.960 5.680 0.864 0.600 0.844 0.960 15.420 0.000 4.908
3 Bujnicki Group (Bujnicki ) 5 Human 0.460 6.221 0.798 0.000 0.800 0.902 17.300 0.000 4.962
4 Das Group (Das ) 2 Human 15.500 7.793 0.745 0.405 0.745 0.876 17.790 0.000 5.804
5 Bujnicki Group (Bujnicki ) 3 Human 26.920 7.527 0.823 0.775 0.767 0.959 16.550 0.000 6.197
6 Bujnicki Group (Bujnicki ) 2 Human 31.890 7.734 0.842 0.548 0.818 0.960 17.930 0.000 6.513
7 Das Group (Das ) 1 Human 15.500 8.860 0.757 0.316 0.745 0.917 18.350 0.000 6.709
8 Das Group (Das ) 3 Human 10.030 9.063 0.745 0.224 0.685 0.960 14.310 0.000 6.749
9 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 5 Human 7.290 8.066 0.850 0.354 0.818 0.981 17.990 0.000 6.859
10 Das Group (Das ) 4 Human 18.230 12.498 0.742 0.365 0.694 0.938 20.750 0.000 9.275
11 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 4 Server 5.930 14.013 0.785 0.447 0.742 0.920 18.710 0.000 10.995
12 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 1 Human 9.120 15.422 0.752 0.000 0.721 0.902 18.960 0.000 11.599
13 Xiao Group (Xiao3 ) 5 Human 1.820 17.307 0.720 - 0.726 0.760 33.650 0.000 12.453
14 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 3 Server 10.030 16.538 0.764 0.258 0.718 0.939 16.120 0.000 12.637
15 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 5 Server 9.570 15.470 0.824 0.632 0.786 0.938 15.450 0.000 12.745
16 Chen Group (Chen ) 2 Human 63.410 19.023 0.701 0.000 0.646 0.898 21.240 0.000 13.335
17 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 4 Human 7.290 18.917 0.739 0.354 0.693 0.885 18.990 0.000 13.979
18 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 2 Human 9.120 19.823 0.767 0.316 0.706 0.960 17.690 0.000 15.202
19 Das Group (Das ) 8 Server 6.380 22.287 0.710 0.000 0.644 0.907 16.750 0.000 15.818
20 Chen Group (Chen ) 4 Human 81.150 19.957 0.797 0.316 0.783 0.898 20.700 0.000 15.904
21 Chen Group (Chen ) 3 Human 72.240 22.503 0.710 0.000 0.662 0.898 18.730 0.000 15.971
22 Das Group (Das ) 5 Human 28.250 21.703 0.740 0.447 0.681 0.917 16.740 0.000 16.050
23 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 2 Server 5.470 21.145 0.760 - 0.709 0.941 17.800 0.000 16.060
24 Das Group (Das ) 9 Server 2.280 23.157 0.697 0.000 0.625 0.907 15.630 0.000 16.147
25 Das Group (Das ) 3 Server 9.570 22.626 0.715 0.000 0.657 0.907 17.150 0.000 16.167
26 Chen Group (Chen ) 5 Human 76.190 29.826 0.543 0.000 0.667 0.367 9.970 0.000 16.182
27 Das Group (Das ) 7 Server 8.660 23.782 0.685 0.000 0.599 0.913 16.450 0.000 16.287
28 Das Group (Das ) 4 Server 3.650 24.033 0.680 0.000 0.599 0.907 16.840 0.000 16.350
29 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 1 Server 7.290 20.744 0.799 0.577 0.719 1.000 18.660 0.000 16.570
30 Das Group (Das ) 10 Server 7.290 23.977 0.697 0.000 0.618 0.928 17.420 0.000 16.718
31 Xiao Group (Xiao ) 3 Human 0.460 31.908 0.532 0.316 0.533 0.568 37.440 0.000 16.961
32 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 3 Human 10.480 22.687 0.748 0.354 0.707 0.885 16.700 0.000 16.977
33 Xiao Group (Xiao2 ) 3 Human 0.910 31.951 0.532 0.316 0.533 0.568 37.440 0.000 16.984
34 Das Group (Das ) 1 Server 6.840 24.160 0.707 0.000 0.645 0.907 17.820 0.000 17.075
35 Das Group (Das ) 2 Server 3.190 24.722 0.702 0.000 0.625 0.928 15.900 0.000 17.354
36 Xiao Group (Xiao3 ) 1 Human 25.570 27.068 0.664 0.289 0.638 0.780 36.440 0.001 17.963
37 Bujnicki Group (Bujnicki ) 1 Server 128.240 47.392 0.381 0.000 0.578 0.000 21.290 0.002 18.075
38 Das Group (Das ) 5 Server 5.010 26.056 0.707 0.000 0.626 0.928 15.710 0.003 18.415
39 Xiao Group (Xiao3 ) 3 Human 38.870 28.060 0.660 0.000 0.691 0.666 29.080 0.003 18.529
40 Das Group (Das ) 6 Server 6.380 25.959 0.719 0.000 0.645 0.945 17.910 0.004 18.675
41 Xiao Group (Xiao3 ) 4 Human 13.680 28.115 0.683 0.000 0.728 0.671 40.540 0.010 19.214
42 Xiao Group (Xiao2 ) 4 Human 23.780 40.082 0.482 0.000 0.542 0.404 35.190 0.012 19.340
43 Xiao Group (Xiao ) 4 Human 23.350 40.099 0.482 0.000 0.542 0.404 35.190 0.012 19.347
44 Xiao Group (Xiao3 ) 2 Human 14.160 29.580 0.669 0.000 0.737 0.610 34.680 0.022 19.783
45 Bujnicki Group (Bujnicki ) 4 Server 100.180 40.725 0.495 - 0.608 0.302 20.360 0.036 20.154
46 Xiao Group (Xiao ) 2 Human 13.690 39.063 0.520 0.000 0.645 0.291 36.760 0.044 20.328
47 Bujnicki Group (Bujnicki ) 5 Server 99.090 40.775 0.501 - 0.650 0.200 21.620 0.048 20.411
48 Chen Group (Chen ) 1 Human 90.040 27.684 0.746 - 0.681 0.941 22.010 0.063 20.650
49 Bujnicki Group (Bujnicki ) 3 Server 97.220 62.217 0.355 0.000 0.563 0.000 23.820 0.238 22.115
50 Bujnicki Group (Bujnicki ) 2 Server 144.030 47.722 0.498 0.000 0.668 0.167 20.500 0.581 23.769
Metric Webserver category Human category
Median Mean Median Mean
Clashscore 7.290 33.315 16.865 26.197
DI 24.005 28.375 19.890 20.331
INF all 0.704 0.659 0.741 0.706
INF nwc 0.000 0.096 0.303 0.229
INF stacking 0.645 0.651 0.700 0.700
INF wc 0.910 0.729 0.898 0.787
MCQ 17.610 18.096 18.975 23.747
P-Value 0.000 0.046 0.000 0.006
RMSD 16.644 17.127 15.553 13.314

Result visualization for different evaluation measures

Violin plot for Clashscore
Violin plot for DI
Violin plot for INF all
Violin plot for INF nwc
Violin plot for INF stacking
Violin plot for INF wc
Violin plot for MCQ
Violin plot for P-Value
Violin plot for RMSD