Completed Puzzles
Puzzle PZ23
Results

Description
Mango-III aptamer
RNA sequence (5' to 3')
GUACGAAGGAAGGUUUGGUAUGGGGUAGUUGUCGUAC
Experimental structure(s)
References
R. J. Trachman 3rd, A. Autour, S. C. Y. Jeng, A. Abdolahzadeh, A. Andreoni, R. Cojocaru, R. Garipov, E. V. Dolgosheina, J. R. Knutson, M. Ryckelynck, P. J. Unrau and A. R. Ferré-DAmaré (2019) Structure and functional reselection of the Mango-III fluorogenic RNA aptamer. Nature Chemical Biology, 15(5): 472-479
PDB ID:
Opening date:
19 Nov 2018, 23:24
Closing date (Human category):
10 Dec 2018, 23:24
Closing date (Webserver category):
21 Nov 2018, 23:24
Display:
Hide or show column:
Metric | Webserver category | Human category | ||
---|---|---|---|---|
Median | Mean | Median | Mean | |
Clashscore | 113.330 | 110.996 | 8.765 | 27.066 |
DI | 22.545 | 23.172 | 23.455 | 53.240 |
INF all | 0.491 | 0.491 | 0.521 | 0.467 |
INF nwc | 0.000 | 0.000 | 0.338 | 0.273 |
INF stacking | 0.587 | 0.584 | 0.524 | 0.490 |
INF wc | 0.612 | 0.618 | 0.802 | 0.670 |
MCQ | 30.760 | 30.010 | 37.150 | 40.066 |
P-Value | 0.013 | 0.013 | 0.030 | 0.100 |
RMSD | 11.443 | 11.350 | 12.047 | 12.197 |
Result visualization for different evaluation measures