Completed Puzzles Puzzle PZ24 Results
Description
adenovirus virus-associated RNA
RNA sequence (5' to 3')
GGACCUCGCAAGGGUAUCAUGGCGGACGACCGGGGUUCGAACCCCGGAUC CGGCCGUCCGCCGUGAUCCAUGCGGUUACCGCCCGCGUGUCGAACCCAGG UGUGCGAGGUCC
Experimental structure(s)
Xt387uVuXXQPsO97UmUtwUxOnJ5BTH3B-solutionPZ24.pdb
References

I. V. Hood, J. M. Gordon, C. Bou-Nader, F. E. Henderson, S. Bahmanjah and J. Zhang (2019) Crystal structure of an adenovirus virus-associated RNA. Nature Communications, 10, 2871

PDB ID:
6ol3
Opening date:
20 May 2019, 23:24
Closing date (Human category):
10 Jun 2019, 23:24
Closing date (Webserver category):
22 May 2019, 23:24

Display:
Hide or show column:

# Group (User) Model(s) Category Clashscore
DI
INF all
INF nwc
INF stacking
INF wc
MCQ
P-Value
RMSD
Details
1 Das Group (DasTFN ) 10 Human 0.550 5.595 0.863 0.000 0.871 0.875 17.130 0.000 4.829
2 Das Group (DasTFN ) 6 Human 4.160 8.301 0.791 0.000 0.760 0.875 18.500 0.000 6.570
3 Das Group (Das ) 9 Server 1.660 9.024 0.851 0.000 0.846 0.896 18.180 0.000 7.680
4 Das Group (DasTFN ) 9 Human 2.220 10.611 0.840 0.000 0.834 0.896 17.260 0.000 8.915
5 Das Group (Das ) 6 Server 2.220 10.611 0.840 0.000 0.834 0.896 17.260 0.000 8.915
6 Bujnicki Group (Bujnicki ) 2 Human 0.280 11.205 0.870 0.000 0.865 0.926 17.080 0.000 9.752
7 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 5 Human 11.920 11.962 0.823 0.000 0.789 0.913 21.150 0.000 9.850
8 Das Group (Das ) 10 Server 3.050 12.161 0.833 0.000 0.826 0.903 17.360 0.000 10.134
9 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 2 Server 11.920 12.580 0.812 0.000 0.758 0.935 25.890 0.000 10.209
10 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 1 Human 10.820 12.935 0.794 0.000 0.760 0.892 19.770 0.000 10.272
11 Dokholyan Group (Dokholyan ) 2 Server 1.670 12.068 0.854 - 0.809 0.957 20.880 0.000 10.301
12 Das Group (DasTFN ) 8 Human 5.820 12.323 0.862 0.000 0.863 0.896 17.530 0.000 10.620
13 Bujnicki Group (Bujnicki ) 3 Human 0.280 13.354 0.807 0.000 0.792 0.892 19.170 0.000 10.777
14 Das Group (DasTFN ) 1 Human 3.330 13.103 0.832 0.000 0.818 0.905 18.790 0.000 10.901
15 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 2 Human 14.420 14.105 0.775 0.000 0.713 0.912 22.950 0.000 10.936
16 Chen Group (Chen ) 5 Server 4.990 13.219 0.835 - 0.774 0.968 23.550 0.000 11.033
17 Das Group (Das ) 7 Server 1.660 14.244 0.856 0.000 0.859 0.896 15.770 0.000 12.198
18 Chen Group (Chen ) 2 Server 4.990 15.719 0.814 0.000 0.739 0.978 21.450 0.000 12.787
19 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 4 Server 8.320 15.894 0.807 0.000 0.751 0.957 19.450 0.000 12.830
20 Das Group (Das ) 8 Server 0.830 15.014 0.861 0.000 0.844 0.925 14.960 0.000 12.922
21 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 3 Server 6.100 16.405 0.791 0.000 0.765 0.888 20.900 0.000 12.975
22 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 1 Server 8.870 16.184 0.821 0.000 0.780 0.925 20.960 0.000 13.286
23 Das Group (DasTFN ) 2 Human 4.990 16.856 0.789 0.000 0.765 0.863 20.270 0.000 13.302
24 Das Group (Das ) 4 Server 0.830 16.587 0.817 0.000 0.808 0.872 15.970 0.000 13.552
25 Das Group (Das ) 7 Human 1.940 15.818 0.862 0.000 0.832 0.989 16.220 0.000 13.633
26 Chen Group (Chen ) 5 Server 147.870 18.663 0.731 0.000 0.646 0.934 24.630 0.000 13.651
27 Bujnicki Group (Bujnicki ) 3 Server 124.860 20.061 0.685 0.000 0.753 0.594 22.120 0.000 13.738
28 Das Group (Das ) 9 Human 1.940 16.585 0.853 0.000 0.824 0.978 17.490 0.000 14.141
29 Chen Group (Chen ) 4 Server 3.050 17.428 0.815 - 0.734 0.979 24.380 0.000 14.196
30 Chen Group (Chen ) 4 Server 155.670 17.744 0.803 0.000 0.717 0.978 24.590 0.000 14.248
31 Chen Group (Chen ) 3 Server 158.980 19.738 0.726 0.000 0.683 0.900 20.190 0.000 14.323
32 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 3 Human 10.540 17.691 0.812 - 0.760 0.924 23.370 0.000 14.372
33 Das Group (Das ) 5 Human 1.940 16.658 0.863 0.000 0.838 0.989 15.910 0.000 14.377
34 Bujnicki Group (Bujnicki ) 5 Human 4.990 17.689 0.824 0.000 0.791 0.915 17.530 0.000 14.583
35 Das Group (Das ) 6 Human 2.220 17.093 0.854 0.000 0.820 0.989 17.820 0.000 14.595
36 Chen Group (Chen ) 1 Server 2.770 17.399 0.847 0.000 0.798 0.978 25.430 0.000 14.738
37 Chen Group (Chen ) 1 Server 144.710 20.102 0.746 0.000 0.706 0.911 19.790 0.000 14.997
38 Bujnicki Group (Bujnicki ) 1 Human 0.550 17.907 0.842 0.000 0.799 0.957 21.040 0.000 15.072
39 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 4 Human 12.200 18.479 0.816 0.000 0.765 0.935 23.090 0.000 15.075
40 Chen Group (Chen ) 2 Server 171.090 19.623 0.782 0.000 0.741 0.934 21.290 0.000 15.353
41 Bujnicki Group (Bujnicki ) 5 Server 96.000 22.591 0.681 0.000 0.739 0.601 21.070 0.000 15.376
42 Xiao Group (Xiao ) 1 Server 0.280 18.863 0.819 0.000 0.807 0.887 21.420 0.000 15.445
43 Chen Group (Chen ) 3 Server 1.940 18.991 0.816 - 0.741 0.968 25.540 0.000 15.497
44 Xiao Group (Xiao ) 4 Server 0.000 19.092 0.816 0.000 0.764 0.945 21.460 0.000 15.572
45 Das Group (Das ) 1 Server 1.660 20.605 0.814 0.000 0.796 0.884 17.590 0.000 16.774
46 Das Group (Das ) 2 Server 0.550 21.104 0.799 0.000 0.783 0.887 15.640 0.000 16.866
47 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 5 Server 5.820 22.712 0.747 0.000 0.701 0.868 19.980 0.000 16.970
48 Xiao Group (Xiao ) 3 Server 0.000 21.676 0.841 0.000 0.813 0.945 20.620 0.000 18.225
49 Bujnicki Group (Bujnicki ) 4 Human 0.280 21.710 0.843 0.000 0.820 0.936 18.850 0.000 18.301
50 Das Group (Das ) 5 Server 0.830 22.195 0.829 0.000 0.816 0.894 16.130 0.000 18.405
51 Xiao Group (Xiao ) 5 Server 1.110 22.128 0.832 0.000 0.809 0.934 19.070 0.000 18.421
52 Das Group (Das ) 3 Server 0.830 22.281 0.856 0.000 0.855 0.887 14.880 0.000 19.079
53 Ding Group (Ding ) 6 Human 11.370 30.548 0.625 0.000 0.676 0.561 18.400 0.000 19.105
54 Ding Group (Ding ) 5 Human 9.430 30.308 0.633 0.000 0.673 0.595 18.660 0.000 19.178
55 Dokholyan Group (Dokholyan ) 1 Server 0.830 24.068 0.806 0.000 0.774 0.934 20.500 0.000 19.395
56 Ding Group (Ding ) 10 Human 8.040 31.291 0.627 0.000 0.665 0.601 18.940 0.000 19.616
57 Xiao Group (Xiao ) 2 Server 0.000 24.306 0.818 0.000 0.805 0.876 19.520 0.000 19.877
58 Ding Group (Ding ) 1 Human 7.490 32.005 0.622 - 0.636 0.613 18.000 0.000 19.910
59 Dokholyan Group (Dokholyan ) 3 Server 2.220 27.481 0.741 0.000 0.749 0.771 22.310 0.000 20.375
60 Ding Group (Ding ) 3 Human 13.030 32.490 0.634 0.000 0.654 0.629 18.570 0.000 20.590
61 Ding Group (Ding ) 2 Human 10.260 34.220 0.608 0.000 0.638 0.608 18.050 0.000 20.821
62 Ding Group (Ding ) 9 Human 9.980 32.604 0.645 0.000 0.685 0.583 18.760 0.000 21.018
63 Bujnicki Group (Bujnicki ) 1 Server 120.700 32.584 0.647 0.000 0.732 0.511 22.190 0.000 21.098
64 Dokholyan Group (Dokholyan ) 5 Server 0.550 34.541 0.670 0.000 0.718 0.666 21.900 0.000 23.158
65 Ding Group (Ding ) 8 Human 9.710 38.654 0.620 0.000 0.642 0.613 18.550 0.000 23.969
66 Bujnicki Group (Bujnicki ) 2 Server 136.290 49.417 0.500 0.000 0.675 0.198 21.560 0.000 24.725
67 Kollmann Group (Kollmann ) 2 Human 128.680 42.644 0.590 0.000 0.694 0.480 19.690 0.000 25.155
68 Ding Group (Ding ) 7 Human 10.820 43.558 0.599 0.000 0.623 0.583 19.610 0.001 26.072
69 Bujnicki Group (Bujnicki ) 4 Server 99.700 44.501 0.589 0.000 0.721 0.387 21.790 0.002 26.224
70 Dokholyan Group (Dokholyan ) 4 Server 1.940 39.168 0.691 0.000 0.744 0.625 22.250 0.008 27.068
71 Ding Group (Ding ) 4 Human 12.760 39.822 0.692 - 0.748 0.583 17.090 0.016 27.557
72 Kollmann Group (Kollmann ) 7 Human 117.550 57.462 0.505 0.000 0.646 0.296 20.250 0.088 29.000
73 Kollmann Group (Kollmann ) 9 Human 104.330 65.186 0.454 0.000 0.622 0.189 20.900 0.152 29.579
74 Kollmann Group (Kollmann ) 10 Human 113.640 63.307 0.467 0.000 0.626 0.228 21.560 0.152 29.586
75 Kollmann Group (Kollmann ) 1 Human 115.470 48.222 0.625 0.000 0.718 0.524 22.860 0.239 30.154
76 Kollmann Group (Kollmann ) 6 Human 92.120 51.090 0.597 0.000 0.708 0.428 19.480 0.307 30.524
77 Kollmann Group (Kollmann ) 4 Human 123.190 58.123 0.552 0.000 0.646 0.468 19.810 0.642 32.088
78 Kollmann Group (Kollmann ) 8 Human 114.070 65.543 0.495 0.000 0.573 0.426 20.940 0.710 32.427
79 Kollmann Group (Kollmann ) 5 Human 121.040 53.283 0.610 0.000 0.658 0.594 21.140 0.728 32.523
80 Kollmann Group (Kollmann ) 3 Human 120.660 58.009 0.567 0.000 0.679 0.457 22.300 0.787 32.864
Metric Webserver category Human category
Median Mean Median Mean
Clashscore 2.495 35.934 10.120 33.726
DI 19.358 20.969 26.009 29.959
INF all 0.814 0.781 0.734 0.710
INF nwc 0.000 0.000 0.000 0.000
INF stacking 0.765 0.768 0.733 0.732
INF wc 0.898 0.847 0.746 0.713
MCQ 20.930 20.511 18.895 19.362
P-Value 0.000 0.000 0.000 0.096
RMSD 15.175 15.815 18.703 19.065

Result visualization for different evaluation measures

Violin plot for Clashscore
Violin plot for DI
Violin plot for INF all
Violin plot for INF nwc
Violin plot for INF stacking
Violin plot for INF wc
Violin plot for MCQ
Violin plot for P-Value
Violin plot for RMSD