Completed Puzzles Puzzle PZ3 Results

Description
The crystallized sequence was slightly different (an apical loop was replaced by a GAAA loop) but it was not mentioned to protect the crystallographers.
RNA sequence (5' to 3')
CUCUGGAGAGAACCGUUUAAUCGGUCGCCGAAGGAGCAAGCUCUGCGCAUAUGC AGAGUGAAACUCUCAGGCAAAAGGACAGAG
Experimental structure(s)
References

L. Huang, A. Serganov and D.J. Patel (2010). Structural Insights into Ligand Recognition by a Sensing Domain of the Cooperative Glycine Riboswitch. Mol. Cell. 40: 774-786.

PDB ID:
Opening date:
19 Oct 2020, 23:24
Closing date (Human category):
19 Oct 2020, 23:24

Hide or show column:

Metric Webserver category Human category
Median Mean Median Mean
Clashscore - - 2.575 18.223
DI - - 21.715 21.588
INF all - - 0.714 0.686
INF nwc - - 0.000 0.186
INF stacking - - 0.699 0.676
INF wc - - 0.861 0.816
MCQ - - 21.505 24.555
P-Value - - 0.339 0.440
RMSD - - 13.879 14.371

Result visualization for different evaluation measures

Violin plot for Clashscore