Completed Puzzles Puzzle PZ28 Results
Description
tRNA complex (Nocardia farcinica ileS)
RNA sequence (5' to 3')
GGGCCUAUAGCUCAGGCGGUUAGAGCGCUUCGCUGAUAACGA AGAGGUCGGAGGUUCGAGUCCUCCUAGGCCCACCA
Experimental structure(s)
iRuMy3FEVaYynvq1BbeDm4l3zKQrNb7s-solutionPZ28.pdb
References

K. C. Suddala and J. Zhang (2019) High-affinity recognition of specific tRNAs by an mRNA anticodon-binding groove. Nature Structural & Molecular Biology, 26(12): 1114-1122

PDB ID:
6ufm
Opening date:
28 Oct 2019, 23:24
Closing date (Human category):
18 Nov 2019, 23:24
Closing date (Webserver category):
30 Oct 2019, 23:24

Display:
Hide or show column:

# Group (User) Model(s) Category Clashscore
DI
INF all
INF nwc
INF stacking
INF wc
MCQ
P-Value
RMSD
TM-score
Details
1 Bujnicki Group (Bujnicki ) 4 Human 18.560 28.493 0.704 0.383 0.684 0.825 26.200 0.000 20.050 0.658
2 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 5 Server 12.550 29.347 0.732 0.275 0.682 0.938 27.320 0.000 21.474 0.396
3 Bujnicki Group (Bujnicki ) 2 Server 138.360 34.271 0.647 0.000 0.638 0.802 26.530 0.000 22.170 0.281
4 Das Group (Das ) 3 Server 10.780 27.001 0.821 0.673 0.793 0.930 19.260 0.000 22.173 0.678
5 Dokholyan Group (Dokholyan ) 4 Server 155.970 36.209 0.618 0.000 0.633 0.719 27.620 0.000 22.390 0.295
6 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 3 Human 8.660 30.411 0.776 0.538 0.729 0.946 23.350 0.000 23.589 0.427
7 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 4 Server 10.250 34.001 0.724 0.343 0.663 0.946 25.210 0.000 24.603 0.534
8 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 3 Server 11.490 36.602 0.733 0.460 0.668 0.946 25.060 0.000 26.826 0.639
9 Bujnicki Group (Bujnicki ) 3 Human 12.550 37.809 0.727 0.458 0.699 0.855 26.070 0.000 27.481 0.662
10 Bujnicki Group (Bujnicki ) 1 Server 145.660 41.915 0.663 0.000 0.652 0.825 27.190 0.000 27.809 0.252
11 Bujnicki Group (Bujnicki ) 4 Server 152.160 43.063 0.654 0.000 0.667 0.752 26.990 0.000 28.145 0.212
12 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 2 Server 9.720 35.435 0.795 0.490 0.758 0.956 22.130 0.000 28.174 0.597
13 Bujnicki Group (Bujnicki ) 5 Human 36.590 39.382 0.718 0.458 0.684 0.859 25.130 0.000 28.281 0.659
14 Dokholyan Group (Dokholyan ) 3 Server 170.090 46.504 0.608 0.000 0.611 0.758 25.380 0.000 28.287 0.306
15 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 5 Human 8.310 36.578 0.784 0.429 0.741 0.964 21.430 0.000 28.660 0.455
16 Das Group (Das ) 10 Human 13.430 34.671 0.832 0.630 0.812 0.932 19.140 0.000 28.840 0.669
17 Das Group (Das ) 8 Server 13.430 34.671 0.832 0.630 0.812 0.932 19.140 0.000 28.840 0.669
18 Bujnicki Group (Bujnicki ) 5 Server 142.980 45.980 0.633 0.000 0.621 0.806 25.490 0.000 29.100 0.178
19 Xiao Group (Xiao ) 2 Human 13.100 57.179 0.514 0.000 0.600 0.429 30.420 0.000 29.403 0.666
20 Bujnicki Group (Bujnicki ) 2 Human 9.900 42.019 0.701 0.383 0.674 0.842 24.940 0.000 29.444 0.657
21 Das Group (Das ) 1 Server 10.960 35.946 0.830 0.583 0.812 0.939 18.980 0.000 29.825 0.703
22 Das Group (Das ) 10 Server 12.900 36.029 0.832 0.605 0.809 0.948 19.190 0.000 29.970 0.671
23 Das Group (Das ) 2 Server 11.490 35.847 0.843 0.648 0.825 0.939 19.140 0.000 30.223 0.702
24 Das Group (Das ) 1 Human 9.900 37.582 0.820 0.583 0.800 0.932 19.050 0.000 30.827 0.685
25 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 1 Human 9.900 39.371 0.787 0.537 0.750 0.930 23.790 0.000 30.967 0.452
26 Das Group (Das ) 8 Human 13.430 38.895 0.796 0.514 0.776 0.930 19.430 0.000 30.971 0.699
27 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 4 Human 9.550 39.592 0.784 0.514 0.739 0.948 23.580 0.000 31.022 0.419
28 Das Group (Das ) 7 Human 9.190 38.023 0.821 0.630 0.798 0.930 19.020 0.000 31.224 0.707
29 Das Group (Das ) 4 Human 10.610 38.065 0.826 0.583 0.809 0.932 19.480 0.000 31.440 0.683
30 Das Group (Das ) 3 Human 12.730 37.725 0.834 0.583 0.818 0.939 19.350 0.000 31.447 0.684
31 Dokholyan Group (Dokholyan ) 2 Server 129.570 49.716 0.636 0.063 0.645 0.779 26.320 0.000 31.629 0.286
32 Xiao Group (Xiao ) 3 Human 12.380 58.657 0.540 0.000 0.614 0.463 29.050 0.000 31.670 0.666
33 Das Group (Das ) 6 Human 10.430 39.342 0.806 0.605 0.779 0.922 19.550 0.000 31.703 0.664
34 Xiao Group (Xiao ) 5 Human 18.390 48.287 0.665 0.000 0.667 0.808 26.180 0.000 32.122 0.666
35 Xiao Group (Xiao ) 4 Human 15.740 59.764 0.541 0.000 0.595 0.536 29.710 0.000 32.314 0.666
36 Xiao Group (Xiao ) 1 Human 21.070 61.331 0.531 0.000 0.609 0.474 27.380 0.000 32.582 0.666
37 Das Group (Das ) 5 Human 10.430 39.058 0.836 0.583 0.825 0.930 18.900 0.000 32.634 0.704
38 Bujnicki Group (Bujnicki ) 3 Server 136.530 51.244 0.638 0.000 0.624 0.794 27.130 0.000 32.679 0.249
39 Chen Group (Chen ) 6 Human 4.240 41.738 0.785 0.673 0.737 0.927 28.720 0.000 32.774 0.618
40 Das Group (Das ) 9 Human 12.550 40.487 0.818 0.546 0.797 0.948 19.350 0.000 33.132 0.666
41 Chen Group (Chen ) 5 Human 2.650 42.638 0.795 0.673 0.732 0.964 29.560 0.000 33.895 0.612
42 Das Group (Das ) 4 Server 11.140 41.972 0.809 0.546 0.792 0.924 18.990 0.000 33.951 0.686
43 Bujnicki Group (Bujnicki ) 1 Human 9.550 47.699 0.713 0.383 0.694 0.835 25.090 0.000 34.001 0.664
44 Dokholyan Group (Dokholyan ) 1 Server 118.190 54.725 0.625 0.000 0.639 0.713 26.030 0.000 34.225 0.221
45 Ding Group (Ding ) 1 Human 11.140 51.999 0.661 0.325 0.615 0.829 25.230 0.000 34.347 0.379
46 Chen Group (Chen ) 4 Human 2.650 42.283 0.812 0.770 0.749 0.964 29.070 0.000 34.352 0.617
47 Das Group (Das ) 7 Server 9.020 41.650 0.830 0.630 0.809 0.932 19.480 0.000 34.563 0.678
48 Das Group (Das ) 9 Server 13.260 43.144 0.811 0.626 0.776 0.946 19.900 0.001 34.976 0.673
49 Das Group (Das ) 5 Server 10.610 42.628 0.825 0.630 0.805 0.924 19.430 0.002 35.170 0.677
50 Chen Group (Chen ) 3 Human 7.250 44.749 0.787 0.583 0.734 0.964 28.750 0.002 35.238 0.631
51 Das Group (Das ) 2 Human 9.190 44.036 0.803 0.564 0.777 0.932 19.120 0.002 35.367 0.666
52 Das Group (Das ) 6 Server 9.190 44.036 0.803 0.564 0.777 0.932 19.120 0.002 35.367 0.666
53 Dokholyan Group (Dokholyan ) 5 Server 131.840 57.429 0.618 0.146 0.599 0.779 26.630 0.003 35.513 0.249
54 Chen Group (Chen ) 10 Human 5.480 46.784 0.792 0.647 0.737 0.955 28.320 0.028 37.057 0.618
55 Chen Group (Chen ) 9 Human 4.240 47.941 0.788 0.673 0.727 0.954 26.970 0.067 37.786 0.630
56 Chen Group (Chen ) 7 Human 5.300 46.515 0.817 0.740 0.760 0.964 28.790 0.082 37.986 0.628
57 Chen Group (Chen ) 1 Human 8.660 50.117 0.766 0.605 0.712 0.927 29.040 0.122 38.390 0.616
58 Chen Group (Chen ) 2 Human 6.010 47.579 0.811 0.690 0.759 0.956 27.530 0.144 38.575 0.623
59 Chen Group (Chen ) 8 Human 5.830 49.100 0.797 0.626 0.758 0.936 29.030 0.228 39.147 0.610
60 Ding Group (Ding ) 2 Human 12.200 55.637 0.709 0.364 0.667 0.875 23.280 0.283 39.456 0.357
61 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 2 Human 11.670 23.428 0.776 0.630 0.722 0.936 24.770 0.000 18.172 0.450
62 Szachniuk Group (formerly: Adamiak Group) (Adamiak ) 1 Server 8.490 24.315 0.807 0.648 0.758 0.964 22.480 0.000 19.630 0.512
Metric Webserver category Human category
Median Mean Median Mean
Clashscore 12.900 63.465 9.900 10.904
DI 41.650 40.147 42.019 43.377
INF all 0.733 0.735 0.787 0.751
INF nwc 0.460 0.342 0.564 0.484
INF stacking 0.682 0.715 0.737 0.726
INF wc 0.930 0.873 0.930 0.870
MCQ 25.060 23.206 25.130 24.696
P-Value 0.000 0.000 0.000 0.026
RMSD 29.100 29.108 32.122 32.063
TM-score 0.534 0.480 0.658 0.611

Result visualization for different evaluation measures

Violin plot for Clashscore
Violin plot for DI
Violin plot for INF all
Violin plot for INF nwc
Violin plot for INF stacking
Violin plot for INF wc
Violin plot for MCQ
Violin plot for P-Value
Violin plot for RMSD
Violin plot for TM-score