Completed Puzzles Puzzle PZ6 Results
Description
adenosylcobalamin riboswitch.
RNA sequence (5' to 3')
CGGCAGGUGCUCCCGACCCUGCGGUCGGGAGUUAAAAGGGAAGCCGGUGCAAGU CCGGCACGGUCCCGCCACUGUGACGGGGAGUCGCCCCUCGGGAUGUGCCACUGG CCCGAAGGCCGGGAAGGCGGAGGGGCGGCGAGGAUCCGGAGUCAGGAAACCUGC CUGCCG
Experimental structure(s)
YtzbGtsy56aPzGPcrIqqCc66vZdeI6lr-solutionPZ6.pdb
References

A. Peselis and A. Serganov (2012). Structural insights into ligand binding and gene expression control by an adenosylcobalamin riboswitch. Nature Structural and Molecular Biology 19 (11): 1182-1184.

PDB ID:
4gxy
Opening date:
19 Oct 2020, 23:24
Closing date (Human category):
19 Oct 2020, 23:24

Hide or show column:

# Group (User) Model(s) Category Clashscore
DI
INF all
INF nwc
INF stacking
INF wc
MCQ
P-Value
RMSD
Details
1 Das Group (Das ) 4 Human 27.700 16.151 0.724 0.316 0.702 0.885 28.100 0.000 11.699
2 Das Group (Das ) 6 Human 28.990 17.080 0.726 0.333 0.702 0.885 29.010 0.000 12.405
3 Das Group (Das ) 2 Human 20.000 18.774 0.726 0.347 0.705 0.885 26.130 0.000 13.627
4 Das Group (Das ) 1 Human 28.070 19.893 0.728 0.333 0.705 0.885 29.520 0.000 14.478
5 Das Group (Das ) 9 Human 20.730 20.942 0.719 0.347 0.694 0.885 26.610 0.000 15.048
6 Das Group (Das ) 3 Human 19.260 21.759 0.724 0.217 0.720 0.874 27.990 0.000 15.752
7 Das Group (Das ) 5 Human 14.670 21.147 0.749 0.361 0.738 0.885 31.280 0.000 15.834
8 Das Group (Das ) 7 Human 15.590 24.363 0.734 0.237 0.731 0.869 27.710 0.000 17.875
9 Das Group (Das ) 8 Human 14.490 24.060 0.746 0.334 0.743 0.877 25.700 0.000 17.956
10 Major Group (Major ) 3 Human 0.730 29.860 0.716 0.204 0.697 0.877 33.370 0.024 21.379
11 Major Group (Major ) 2 Human 0.370 30.092 0.724 0.204 0.716 0.862 33.480 0.039 21.778
12 Chen Group (Chen ) 4 Human 1.830 33.937 0.653 0.000 0.627 0.837 27.370 0.060 22.152
13 Chen Group (Chen ) 2 Human 0.180 37.231 0.598 0.289 0.578 0.715 30.750 0.068 22.261
14 Major Group (Major ) 1 Human 0.550 29.866 0.745 0.335 0.735 0.865 30.120 0.068 22.264
15 Major Group (Major ) 4 Human 0.550 30.836 0.723 0.204 0.703 0.889 32.410 0.071 22.304
16 Major Group (Major ) 7 Human 1.100 30.958 0.721 0.289 0.695 0.877 31.450 0.072 22.319
17 Dokholyan Group (Dokholyan ) 5 Human 10.640 34.109 0.668 0.000 0.644 0.854 24.730 0.113 22.769
18 Major Group (Major ) 6 Human 0.550 31.940 0.731 0.289 0.704 0.889 31.210 0.185 23.341
19 Chen Group (Chen ) 5 Human 17.060 36.809 0.643 0.000 0.624 0.821 27.220 0.240 23.682
20 Chen Group (Chen ) 3 Human 0.550 37.437 0.635 0.112 0.588 0.854 31.070 0.253 23.754
21 Chen Group (Chen ) 1 Human 0.370 39.881 0.609 0.177 0.573 0.800 30.100 0.357 24.292
22 Major Group (Major ) 5 Human 0.730 34.909 0.696 0.102 0.683 0.858 32.130 0.357 24.294
23 Dokholyan Group (Dokholyan ) 4 Human 10.090 37.192 0.674 0.000 0.654 0.854 25.580 0.525 25.066
24 Dokholyan Group (Dokholyan ) 1 Human 11.190 38.982 0.673 0.000 0.656 0.838 24.220 0.763 26.241
25 Dokholyan Group (Dokholyan ) 3 Human 8.810 38.104 0.692 0.000 0.687 0.842 24.300 0.785 26.371
26 Dokholyan Group (Dokholyan ) 2 Human 9.540 38.573 0.693 0.000 0.682 0.834 25.800 0.838 26.724
27 Das Group (Das ) 10 Human 24.410 41.226 0.708 0.250 0.698 0.877 28.700 0.991 29.182
28 Bujnicki Group (Bujnicki ) 2 Human 1.280 45.564 0.680 - 0.669 0.814 22.460 1.000 30.968
29 Chen Group (Chen ) 7 Human 10.090 49.502 0.628 0.000 0.606 0.801 29.040 1.000 31.065
30 Bujnicki Group (Bujnicki ) 4 Human 2.020 49.279 0.652 0.000 0.648 0.784 22.610 1.000 32.131
31 Bujnicki Group (Bujnicki ) 3 Human 0.920 53.891 0.597 - 0.593 0.701 23.780 1.000 32.166
32 Chen Group (Chen ) 6 Human 2.380 56.435 0.641 0.000 0.619 0.809 24.760 1.000 36.164
33 Bujnicki Group (Bujnicki ) 1 Human 0.550 54.362 0.682 0.000 0.672 0.850 22.610 1.000 37.066
34 Dokholyan Group (Dokholyan ) 6 Human 14.490 57.436 0.652 0.000 0.647 0.780 25.180 1.000 37.465
Metric Webserver category Human category
Median Mean Median Mean
Clashscore - - 9.175 9.426
DI - - 34.509 34.782
INF all - - 0.694 0.689
INF nwc - - 0.191 0.155
INF stacking - - 0.685 0.672
INF wc - - 0.856 0.844
MCQ - - 27.850 27.838
P-Value - - 0.149 0.377
RMSD - - 23.055 23.584

Result visualization for different evaluation measures

Violin plot for Clashscore
Violin plot for DI
Violin plot for INF all
Violin plot for INF nwc
Violin plot for INF stacking
Violin plot for INF wc
Violin plot for MCQ
Violin plot for P-Value
Violin plot for RMSD